                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:35 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-10.74 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-17.50 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G=-10.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tcgcggttcagatcgtagaatttcttgccggtatcggggtctgtacgcttggtaccaagttccgtttttgccactgtctaagcctcaaattgtcgaatga
gtttcggtgtgtacgccgtaaaaccggcatagacggtaaaatttatagccggtccccttaatcgttgcgctctttcgtgtcaaagacaaacttcgggtgc
tgcctcccatggcgcaagcccgatgtgtgaatgctgatataaaaagagaggcattacacactttattatatctataacggatgcacagacgggacgcttc
ATG

    cmk Gene: cmk     GI: 17937798     BI number: Atu4103     GOG: COG0283     Description: cytidylate monophosphate kinas            cc   a       c  a a  a      t  t cg        cg        aa ta        cg       a  a gc        gc       t  a ta        tg       a  g |  a      |  c      t  a g  a      c  a      a  g c  c      g  a      g  a t  t       tg        tg t  t       gc        cg t  c       gc        gc cg        gc        ta tg        cg        at cg        ta        at gt       t  t      |  a cg        cg        gc gc        at        ta t  t      a  g       gc tg        at        ta gc        cg        gc                         tttattatatctataacggatgcacagacgggacgcttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG0283 Cytidylate kinase ... can be seen here     ..................................................................................................................