                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:14 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-22.50 kcal/mol

                                                                        Nomenclature/Definitions

CCGTGCGCAATGGTGCAACAAGGAGTTCTCCGAACTTCTTTCCAAGGCAAAGCAGACC
ACTGATGTTGCCGAGCGCACCAAGCTTTACGAGCAGGCGCAGGTGATCTTCAAGGAAC
AGGCTCCGTGGGCGACGCTTGCGCACTCCACGCAGTTCGTTCCGATGTCCGCCAAGGT
TTCCGGCTTCACCATGAGCCCGCTTGGCGACTTCACCTTCGAAAACGTCGATATCGCT
GAGTAAtcccaaacaactggacgcgcggaagaaccctgttcttccgcgcgtcttttcaggaaaaaaccATG

    dppB_lrep_1 --- dppC --- dppD --- dppF Gene: dppB_lrep_1     GI: 17937809     BI number: Atu3379     GOG: COG0601     Description: ABC transporter, membrane spanning protein [dipeptide] Gene: dppC     GI: 17937810     BI number: Atu4115     GOG: COG1173     Description: ABC transporter, membrane spanning protein [dipeptide] Gene: dppD     GI: 17937811     BI number: Atu4116     GOG: COG0444     Description: ABC transporter, nucleotide binding/ATPase protein [dipeptide] Gene: dppF     GI: 17937812     BI number: Atu4117     GOG: COG4608     Description: ABC transporter, nucleotide binding/ATPase protein [dipeptide            c          c  t           cg           at           at           gc           at           at           gc           gc           cg           gc           cg           gc           cg             tcttttcaggaaaaaaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [EP] COG0601 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here [EP] COG1173 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here [EP] COG0444 ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component ... can be seen here [E] COG4608 ABC-type oligopeptide transport system, ATPase component ... can be seen here     ..................................................................................................................