                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:44 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-11.80 kcal/mol
Antiterminator: Size=59 nt.     Delta G=-14.61 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G= -8.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAACGCGATCGCTGCTTGTCTGCGGAAAAATGCTGATGTCGGCGATCAGAGCTTCGAG
TGTTGCCGCAACATAGGCATCGCCCGTTGATTGTGAGCCGCAAACGGCACGCGCGAAC
CTGCGAAGATATGGCAGGTGCGGTGCGATGCGTGTAGAAACTGACATggaattctcccctttcat
gcggtctgcaacgcaaacccaagatagcaacgtgtgtatcgcaaaaaaagttccggaccgccggaactatttttttaaccgcgcattcttgccacgacac
aaaaggaataccggacgttATG

    Atu4161 --- Atu4160 Gene: Atu4161     GI: 17937856     BI number: Atu4161     GOG: -------     Description: conserved hypothetical protein Gene: Atu4160     GI: 17937855     BI number: Atu4160     GOG: COG1595     Description: ECF family sigma facto             c           a  g           a  t            cg            gt           |  g            at            ta            at            gc           a  g           a  c           c  a           c  a           c  a tc       a  a c  c      a  a t  c      a  a t  c      c  a at       g  | at        cg gt        at        cc gc        at       a  g Ta       c  c       gc At        gc        gc Cg        tg        cg A  |       cg        cg Gc        ta        ta Tg        gc        ta Cg        gc        gc At        cg        at                         atttttttaaccgcgcattcttgccacgacacaaaaggaataccggacgttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1595 DNA-directed RNA polymerase specialized sigma subunit, sigma24 homolog ... can be seen here     ..................................................................................................................