                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:61 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-11.00 kcal/mol
Antiterminator: Size=27 nt.     Delta G= -4.14 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGAGTTTTTCGAGAAGATCGAGGAATTTGTCAGGGATGCCTTCTTCCTGAACGGCATC
ATAGAGCTCCCTGAGCTTGCGGGAAATCACCGCCCGCCCGGAATGTGGAACCTGGGGG
GGCGCCGAGTTGTCCGGCGAATCTTGGTCCGATTGAAACATGCTCATaacgtccggtattccttt
tgtgtcgtggcaagaatgcgcggttaaaaaaatagttccggcggtccggaactttttttgcgatacacacgttgctatcttgggtttgcgttgcagaccg
catgaaaggggagaattccATG

    Atu4162 --- Atu4163 Gene: Atu4162     GI: 17937857     BI number: Atu4162     GOG: COG0784,COG1595     Description: two component response regulator Gene: Atu4163     GI: 17937858     BI number: Atu4163     GOG: COG3920     Description: two component sensor kinas aa a  a a  t a  a a  g       gg t  t      c  t t  t       gc gc        gc gc        cg cg        cg g  |       ta cg        ta gc        gc tg        at             ttttttgcgatacacacgttgctatcttgggtttgcgttgcagaccgcatgaaaggggagaattccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG0784 FOG: CheY-like receiver ... can be seen here [K] COG1595 DNA-directed RNA polymerase specialized sigma subunit, sigma24 homolog ... can be seen here [T] COG3920 Signal transduction histidine kinase ... can be seen here     ..................................................................................................................