                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:70 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G= -8.90 kcal/mol
Antiterminator: Size=34 nt.     Delta G=-16.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCTGCGCACGCGCTACCGAAACGGCGCCAATGTGACTGTAGTGAAAGAAGCTATGGA
AATCATGGGGCTCGCCGTCGGTCCGGTGCGCGCCCCTGGGCTCGTGCGCTTGGATGCG
CCTGACCGCGCTTTGCTCGAAAACCTGCTGGCCAGCTGGAAATAAcctcccaagggcgagatgctcc
caacgctttcggacgttgagagcatcatacgacgatgctgttatttttcatgtgagtttgatccatttttccgttttgccgtgatccacatccacgctcg
accgatcatcaccgggaTTG

    Atu4188 Gene: Atu4188     GI: 17937877     BI number: Atu4188     GOG: -------     Description: hypothetical protei tc t  g t  g c  a        c gc       a  g cg       t  a at       a  c at        cg cg        ta c  a       at cg        cg ta        gc cg        at gc       g  g ta        at at        gt gc        ta             tttttcatgtgagtttgatccatttttccgttttgccgtgatccacatccacgctcgaccgatcatcaccgggaTTG     ..................................................................................................................