Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:185 nt.     Distance to run of Ts=0 nt.   Size=40 nt.     Delta G=-17.20 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -5.60 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-12.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGATTTCCTCCCAAaagatcgcaggtcgcagcgaggtgcagaacctcgttacttcagccctcctggccgacccacgtgccgatcctcc
atcggcacggtgaccatatgggtgttttcagatgattacaagtattgacagatttttacatattttttattcatggatggagttttcgcaatcagatgcc
ccgttcgcggttgggagttgatcagcttccagcgcgcctgtagagacgcacttgatacgatgtgaaatgaaatgctgaaaagattcagcgatttgcgacg
agagggcgcagATG

    Atu4191


Gene: Atu4191     GI: 17937880     BI number: Atu4191     GOG: COG2186     Description: transcriptional regulator, GntR famil


  a
c  g                  t
g  a                c  c
 ta                 c  c
 gc                  ta
 gc         c        at
 at       t  c       gc
 gc       c  t       cg
 cg        cg        cg
 gt        cg        gc
 at        gc        ta
c  |      a  c       gc
g  |       cg        cg
c  |       ta       |  g
 ta       |  c      |  t
 gc       |  c      |  g
 gt       |  c      |  a
 at       |  a      |  c
|  c      t  c      |  c
|  a       cg       |  a
 cg        at       |  t
 gc        tg       |  a
c  c      t  c       at
t  c       gc        cg
 at        cg        cg
 gc        ta        cg
                        tgttttcagatgattacaagtattgacagatttttacatattttttattcatggatggagttttcgcaatcagatgccccgttcgcggttgggagttgatcagcttccagcgcgcctgtagagacgcacttgatacgatgtgaaatgaaatgctgaaaagattcagcgatttgcgacgagagggcgcagATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[K] COG2186 Transcriptional regulators ... can be seen here

    ..................................................................................................................