                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:112 nt.     Distance to run of Ts=3 nt.   Size=37 nt.     Delta G=-21.90 kcal/mol
Antiterminator: Size=63 nt.     Delta G=-11.70 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-23.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTCGATGCCATCCGCAAGGGGGACGGTGACGCCGCTTACAAAGCCGCGCTCGATCATG
TGACCAGCGCCTGTGCCATTGCCGAAGCCGTCCTGACGGCGCAAAAAACCGCCGACTG
Acggatttttcggctgaaatcgatccattcttgtggctcccctgccgggagccgcataggtgttcttatttactttatcgttgtttttcaataatttaga
aaaataattagccgcttcttgacagggtaaaccgtttggtgtgatggtatgccataatcaataatataaagagcggagcttaatATG

    Atu4233 Gene: Atu4233     GI: 17937922     BI number: Atu4233     GOG: COG0834     Description: ABC transporter, substrate binding protein [amino acid            gc           g  t            cg            ta            ta            ta AA       |  t A  A      |  c A  A       tg C  C       ta GC        at CG        gc GC        gc GC       |  a CG       c  t A  A       At         g G  C       Gc       t  c T  T      T  t      c  c C  |      C  t       cg CG       A  g       cg TA        Gt        cg Gc        Cg        ta Cg        Cg        cg Cg        Gc        gc |  a      C  t       gc |  t      C  c       tg |  t      A  c       gc G  t      A  c       ta At       A  c      t  t At       A  |      c  a Gc       A  |       tg Cg        At        tg Cg        Cg        at Gc        Gc        cg                         ttcttatttactttatcgttgtttttcaataatttagaaaaataattagccgcttcttgacagggtaaaccgtttggtgtgatggtatgccataatcaataatataaagagcggagcttaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [ET] COG0834 ABC-type amino acid transport/signal transduction systems, periplasmic component/domain ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:175 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-14.20 kcal/mol Antiterminator: Size=26 nt.     Delta G= -9.20 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GTCGATGCCATCCGCAAGGGGGACGGTGACGCCGCTTACAAAGCCGCGCTCGATCATG TGACCAGCGCCTGTGCCATTGCCGAAGCCGTCCTGACGGCGCAAAAAACCGCCGACTG Acggatttttcggctgaaatcgatccattcttgtggctcccctgccgggagccgcataggtgttcttatttactttatcgttgtttttcaataatttaga aaaataattagccgcttcttgacagggtaaaccgtttggtgtgatggtatgccataatcaataatataaagagcggagcttaatATG     Atu4233 Gene: Atu4233     GI: 17937922     BI number: Atu4233     GOG: COG0834     Description: ABC transporter, substrate binding protein [amino acid            AA           A  A           A  A CT       C  C C  G       GC TA        CG GC        GC CG        GC CG        CG GC       A  A A  |      G  C A  |      T  T G  |      C  | C  |       CG CG        TA GC        Gc TA        Cg TA        Cg             atttttcggctgaaatcgatccattcttgtggctcccctgccgggagccgcataggtgttcttatttactttatcgttgtttttcaataatttagaaaaataattagccgcttcttgacagggtaaaccgtttggtgtgatggtatgccataatcaataatataaagagcggagcttaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [ET] COG0834 ABC-type amino acid transport/signal transduction systems, periplasmic component/domain ... can be seen here     ..................................................................................................................