                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:26 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-15.30 kcal/mol
Antiterminator: Size=16 nt.     Delta G= -8.30 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G=-18.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCGAAGGCAGGCTCGTGGCGCGGGGACTGCCCGGCGCATTGGTCAAGGACGAGACGT
CGGTGCGCGCGCGGGTTCGACGGTTCCTGACACATGGTCAGGTCGAGGCCATCGATGG
CACGATCATCGCCATGCCCGCTCACTCTATCCTCGTCCACAGCGATACGCCCGGTTCT
CTGGAACTTGCACGCATCATCCGCAGTGAAATCGAGGCTTCCGGCGCCACTCTGGCGC
CTGCGGCCGAACACGCGGCCTGAgccggtcgctgtttgttgtttccatctcatcgaaagattacccagATG

    aatA Gene: aatA     GI: 17937967     BI number: Atu4278     GOG: COG0436     Description: aspartate aminotransferase   T                  Ag C  C                G  c A  T                T  c CG                  Cg CG                  Cg GC                  Gt CG                  Gc GC                  Cg GC        CA        Gc C  T      A  C      C  | C  G      A  G       At T  C       GC        Cg TG        CG        At CG        CG        At GC        GC        Gt GC        GC        Cg                         ttgtttccatctcatcgaaagattacccagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0436 Aspartate/tyrosine/aromatic aminotransferase ... can be seen here     ..................................................................................................................