                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:136 nt.     Distance to run of Ts=3 nt.   Size=18 nt.     Delta G=-11.60 kcal/mol
Antiterminator: Size=32 nt.     Delta G=-17.80 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-16.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGGGACTACTGAcggcctgttgatctacaggtctaccaagtgaccacatgcgatcgggcagccagcagatcgcatgcggtttttcgggtc
gccggtgctttggccctatgcgcggagccggcaggatcctgtcgcctgtgcccgcgcaggccactgttttctgcaacttgaacaataggcgacaaaggcg
gcagaatttgataaaatgcaagtcagccggttgcggtttgacgcacggataaaagtcaccgggcgttcctgtgccgccagccggatcatggcgcaggagg
agaagtgctATG

    Atu4308 Gene: Atu4308     GI: 17937997     BI number: Atu4308     GOG: COG5473     Description: conserved hypothetical protei gc t  t gt gt cg cg gc |  c |  c c  t       at ta       g  c gt        gc g  g       at gc        cg cg        gt t  c       gc t  g      c  | tg        cg        cc ta        gc       c  g tg       a  |       gc gc        gc        tg gc        gt        gc |  g       cg        ta cg        gt        cg gc        cg        cg ta        gc        gc                         cactgttttctgcaacttgaacaataggcgacaaaggcggcagaatttgataaaatgcaagtcagccggttgcggtttgacgcacggataaaagtcaccgggcgttcctgtgccgccagccggatcatggcgcaggaggagaagtgctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG5473 Predicted integral membrane protein ... can be seen here     ..................................................................................................................