Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:87 nt.     Distance to run of Ts=2 nt.   Size=34 nt.     Delta G=-26.90 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -9.04 kcal/mol
Anti-antiterminator:   Size=15 nt.     Delta G= -5.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttacgcgccaagattgccaaaccgcaccgttttggcagcaaaaaatcgaaagccgcttttccaaccgtcggaaatttgctagttggaccggcacaagaat
tgactgatagtgggataaatccgccctatgcctgacgaaggcgacagtaccgacagtagtcgacaccgaacgaggctggctcgcataacgcgacgccagc
ctcgaattttcttgtttttttcaaagcagcggctttcagcctcggatggtcggtccggggctttgcgcgtttgcacccattcccataaaggctcctgaac
ATG

    Atu4355


Gene: Atu4355     GI: 17938044     BI number: Atu4355     GOG: COG0861,COG1253     Description: conserved hypothetical protei


           gt
          a  a
           cg
           at
           gc
           cg
          |  a
          |  c
          |  a
          |  c
          |  c        a
          |  g      t  a
          |  a      a  c
          |  a       cg
          |  c       gc
          |  g       cg
          c  a       ta
          a  g      |  c
           tg        cg
           gc        gc
  c        at        gc
a  g       cg        ta
g  a      |  g       cg
 ta       |  c       gc
 cg        at        gc
 cg        gc        at
 gc        cg        gc
 tg        gc        cg
                        aattttcttgtttttttcaaagcagcggctttcagcctcggatggtcggtccggggctttgcgcgtttgcacccattcccataaaggctcctgaacATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[P] COG0861 Membrane protein TerC, possibly involved in tellurium resistance ... can be seen here
[R] COG1253 Hemolysins and related proteins containing CBS domains ... can be seen here

    ..................................................................................................................