                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:26 nt.     Distance to run of Ts=1 nt.   Size=25 nt.     Delta G= -8.90 kcal/mol
Antiterminator: Size=34 nt.     Delta G=-10.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGTTCTCGACTGGAAGGCAATTCTGCCGGCGGCCAAGCAGGCCGGTGTCAAGCTGTT
CATTCTTGAACACGACCTTCCGCTCGATGCCGAAGCGGTCGTGACCAAGGGTAACGCG
TTCCTGAACGAACGCCTTCCGACCCTTCAGTAAacactgccagtaaaaccagaaccgctccccggcggcgggtttc
gccggggcgcatgaggttcgacagacgcatagccagtttccgccgcattgcgacggggagcgcttcgtctcgtcgagtttttcccaaagaccactcggag
gagttatcATG

    Atu4377 --- Atu4378 Gene: Atu4377     GI: 17938066     BI number: Atu4377     GOG: COG2303     Description: oxidoreductase Gene: Atu4378     GI: 17938067     BI number: Atu4378     GOG: NOG15593     Description: conserved hypothetical protei   t a  t cg gc cg         t c  a      c  t gc        gc cg        cg cg        gt tg       a  | tg       g  | ta        gc g  g       gt a  c       gc c  |       cg cg        at gc        gc at        cg             agtttttcccaaagaccactcggaggagttatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG2303 Choline dehydrogenase and related flavoproteins ... can be seen here     ..................................................................................................................