                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:148 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-22.30 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -8.46 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G=-16.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAACGGTGAATACCTATGAGGGCACGCATGACGTGCACGCGCTGATCCTCGGCCG
GGCGCAGACGGGCATTCAGGCGTTTTTCTGAggtttcatccgcatcccCTACACCAGGAAAAGGC
CTTCGAAGTTCGCTTCGAAGGCCTTTGTTTTCGAACTCGGATGCTGACGTTCCAAGCG
CTTGGCGAGGGGATTGCAAGACCGGATGATATGGCCGATAGGATGCCGTTTCTCTCCG
GTCCTGATTGACGAGGCGATATCTGCGGCCCGACCCGACCGGAAAAACAAggggaagatttA
TG

    Atu4416 Gene: Atu4416     GI: 17938105     BI number: Atu4416     GOG: COG2977     Description: phosphopantetheinyl transferas   G G  C G  A C  T AT GC |  A A  G CG GC CG GT GT         C GT       c  T C  T      c  A C  T      c  C GC       t  A GT       a  C       TC CG       c  C      T  G TA       g  A       GC Cg        cG        AT Cg        cG        AT |  t       tA        GC |  t      a  A       CG |  t      c  A       TA |  c       tA        TA Ta        tG        CG At        tG        CG Gc        gC        GC T  c       gC        GC Cg        AT        AT Gc        GT        AT                         TGTTTTCGAACTCGGATGCTGACGTTCCAAGCGCTTGGCGAGGGGATTGCAAGACCGGATGATATGGCCGATAGGATGCCGTTTCTCTCCGGTCCTGATTGACGAGGCGATATCTGCGGCCCGACCCGACCGGAAAAACAAggggaagatttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [Q] COG2977 Phosphopantetheinyl transferase component of siderophore synthetase ... can be seen here     ..................................................................................................................