                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:23 nt.     Distance to run of Ts=2 nt.   Size=36 nt.     Delta G=-19.60 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -4.40 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-19.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGTTGCCGCCGTCTGTCACGGTGCGCAATTGCTGGCGGCTGCCGGCGTGCTCAAGGGC
CGTACCTGCTCGGCCTATCCCGCCTGCCGCCCCGAGGTGGAACAGGCAGGCGGCACCT
ATGCCGACATCGCAATCGATGCCGCCGTCACCGACGGCAAGCTGGTAACGGCGCCCGC
CTGGCCGGCGCATCCGGCATGGCTCTCGCAATTCATGACGGTGCTCGGCAAATAAgacc
agcgaaacggggcttttgcccgccccgttttccgcttatgttttggaacgtggtgagggaggaaaccATG

    Atu4443 Gene: Atu4443     GI: 17938132     BI number: Atu4443     GOG: COG4321     Description: conserved hypothetical protei CT T  C CG GC |  A |  A |  T |  T                 tg GC                 t  c TA         T       t  c AT       A  A      t  c CG       A  A       cg G  A      A  g       gc GC       C  a       gc CG        Gc        gc CG        Gc        gc T  |      C  |       cg AT        Ta        at CG        Cg        at GC        Gc        at C  |       Tg       |  t GT       |  a      |  c GC       |  a       gc CG       G  a       cg CG        Gc        gc GC        Cg        at                         tatgttttggaacgtggtgagggaggaaaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG4321 Uncharacterized protein related to arylsulfate sulfotransferase involved in siderophore biosynthesis ... can be seen here     ..................................................................................................................