Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:165 nt.     Distance to run of Ts=2 nt.   Size=28 nt.     Delta G=-13.30 kcal/mol
Antiterminator: Size=65 nt.     Delta G= -6.82 kcal/mol
Anti-antiterminator:   Size=27 nt.     Delta G= -4.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GATTCACGTCTGTCACcaatttctgttgcgattaactcgcaataccatccgttatggaatcacagatgtcaacgctattgcaaatcat
tctcaatttaactgatttcggaaatgtccgaaattggtgcgtttttggccggacggaggcagcccggttaaacttttttcaatgagaaagcggcactatc
gcagggctcggacagcgtggtccgtggcttgtcccgcgtgtgttcctcatctttcgagccacggtccggggcgagggcttaaggcggggtacttgatgtc
aggatgttgcggGTG

    Atu4472


Gene: Atu4472     GI: 17938161     BI number: Atu4472     GOG: NOG13333     Description: hypothetical protei


           at
          t  t
           cg
           gc
          c  a
          a  a
          a  a
          c  t
          t  |
           gc
           ta
           at
           gt
          |  c
          |  t
          |  c
          |  a
          |  a
          |  t
          |  t
          |  t
          |  a
          a  a
  c       c  c
a  a       at        at
 cg        cg       a  g
 ta        ta        at
 at        at        gc
a  g       at        gc
g  t       gt        cg
 gc        gc        ta
 ta        tg        ta
a  |      |  g       ta
t  |      a  a       at
 ta        ta       g  t
 gc        ta       t  g
 cg        gt        cg
 Gc        cg        at
                        gcgtttttggccggacggaggcagcccggttaaacttttttcaatgagaaagcggcactatcgcagggctcggacagcgtggtccgtggcttgtcccgcgtgtgttcctcatctttcgagccacggtccggggcgagggcttaaggcggggtacttgatgtcaggatgttgcggGTG


    ..................................................................................................................