                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:75 nt.     Distance to run of Ts=1 nt.   Size=29 nt.     Delta G=-10.10 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-10.54 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G=-21.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTTCAAGCTGCGCCTGTTCGGCGAGATCGACGGCCCGGTTCCGGAAGAGGAGCTGGAC
CGGGTGATCGCCAGCGCCATCAAGGTGTTCATGGCGGCCTACGGAACCGACAAGGTCT
GAaatcattcagcaacgggcgaccggaccggcaacggcacggggcctgatacgcggtttacgcgaaatttcgatgaaatcctgcccatgacaggcgggg
cctccttgtttctcgcgtattgcgctataaattccacgaaccgaatgtttcgggtggccttgttgctgaaaggaaaaattccctgATG

    Atu4476 Gene: Atu4476     GI: 17938165     BI number: Atu4476     GOG: COG0861     Description: conserved hypothetical protei ca g  a gc cg cg         t a  c      t  t g  a      g  a gc        gc cg        cg cg        gc a  g       cg g  |      |  a cg       |  a gc       |  a gc       |  t gt       |  t cg       |  t |  a      |  c |  t      |  g        g a  a      |  a      t  a a  c      |  t      a  c cg       |  g      c  a gc       |  a       cg a  |      a  a       cg c  |       ta        gc t  |       at        tg t  |       gc        cg a  |      t  c       cg cg       c  t       tg tg        cg       a  c at        gc       a  c at        gc        at At        gc        gc                         cttgtttctcgcgtattgcgctataaattccacgaaccgaatgtttcgggtggccttgttgctgaaaggaaaaattccctgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0861 Membrane protein TerC, possibly involved in tellurium resistance ... can be seen here     ..................................................................................................................