Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:176 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-20.80 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -7.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTTCATGACCGTGCTGATCCAGAAACCCAAGGCAGCGCCGCCACCAGACGCGGCGCAC
TGAaccaaatcccctcccatccaccgcagagctggggccgtcggaaatgacggccccttttttgttttggcaaaaaaaaagcgcgtgtccgagcgcca
gaggctgttgatcacaacggacaagccatgtatatcaatttttgaggtacgtacctcaattagtgcttgagcggacgaaaacggggccgggaggacggtt
gacccgggttcaggccgcatgggcgggcagttcaggaggaagagATG

    Atu4480


Gene: Atu4480     GI: 17938169     BI number: Atu4480     GOG: COG3576     Description: conserved hypothetical protei


  c
c  g
a  c
c  a
 cg
 ta
a  g
c  c
c  t
c  |       aa
t  |      g  a
 cg        gt
 cg        cg
 cg        ta
 cg        gc
t  c       cg
a  c       cg
a  g       gc
a  |       gc
c  |       gc
c  |       gc
a  |      t  t
 At       c  t
 Gc        gt
 Tg        at
 Cg        gt
            tgttttggcaaaaaaaaagcgcgtgtccgagcgccagaggctgttgatcacaacggacaagccatgtatatcaatttttgaggtacgtacctcaattagtgcttgagcggacgaaaacggggccgggaggacggttgacccgggttcaggccgcatgggcgggcagttcaggaggaagagATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG3576 Predicted flavin-nucleotide-binding protein structurally related to pyridoxine 5'-phosphate oxidase ... can be seen here

    ..................................................................................................................