                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:118 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-13.00 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-12.30 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-25.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGCCCGGAAGTGAAGGCCTTCATTCTGGAAAAGTACAACGGCACGGTCATCCCGTCC
TGGTAAgaaactgccgcatggtggaaatgaggacctctcccgttcgcgggggaggttttttgtttggagaccagcgataaccggttttccctgaaa
aacccccgccatttcagggaaagatttttcagcctgtcgcccggactgtcgttttgtacccgttgttttttgggggcggcgttgcggggcggtttaacgc
cttttgaatgtttccttcgcaagatgatgctttcaaaggggattttATG

    Atu4490 Gene: Atu4490     GI: 17938179     BI number: Atu4490     GOG: COG2199,COG2200     Description: GGDEF family protei tc t  g gc cg cg cg tg        at cg       g  a ta       c  a cg       g  c cg       a  c at        cg gt        cg         c gt        at       c  c at        gt       c  g gt        at       c  c t  t       gt       a  c a  g       gc       a  a a  |      t  c       at at       t  c       at gt       t  |       at gt        gt        gc |  g       tg        ta |  g       ta        cg |  a       ta        cg |  g       ta        cg ta        ta        ta gc        ta        ta gc        gc        ta ta        gc        tg                         atttttcagcctgtcgcccggactgtcgttttgtacccgttgttttttgggggcggcgttgcggggcggtttaacgccttttgaatgtttccttcgcaagatgatgctttcaaaggggattttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG2199 FOG: GGDEF domain ... can be seen here [T] COG2200 FOG: EAL domain ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:179 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-21.10 kcal/mol Antiterminator: Size=38 nt.     Delta G= -9.90 kcal/mol Anti-antiterminator:   Size=48 nt.     Delta G= -9.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CAGCCCGGAAGTGAAGGCCTTCATTCTGGAAAAGTACAACGGCACGGTCATCCCGTCC TGGTAAgaaactgccgcatggtggaaatgaggacctctcccgttcgcgggggaggttttttgtttggagaccagcgataaccggttttccctgaaa aacccccgccatttcagggaaagatttttcagcctgtcgcccggactgtcgttttgtacccgttgttttttgggggcggcgttgcggggcggtttaacgc cttttgaatgtttccttcgcaagatgatgctttcaaaggggattttATG     Atu4490 Gene: Atu4490     GI: 17938179     BI number: Atu4490     GOG: COG2199,COG2200     Description: GGDEF family protei   A C  T T  C GC GC CG AT        ca C  C      g  t GC        cg GT        cg CG        gt |  G       tg |  T       cg        tc |  A      a  a      t  g A  A      a  a       gc A  g      a  |       cg C  a      g  |       cg A  a      A  |       cg Ta       A  |       tg Gc        Ta        cg At        Gt        ta A  g      G  g       cg A  |       Ta        cg A  |       Cg        at Gc        Cg        gt Gc        Ta        gt Tg        Gc        at                         ttgtttggagaccagcgataaccggttttccctgaaaaacccccgccatttcagggaaagatttttcagcctgtcgcccggactgtcgttttgtacccgttgttttttgggggcggcgttgcggggcggtttaacgccttttgaatgtttccttcgcaagatgatgctttcaaaggggattttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG2199 FOG: GGDEF domain ... can be seen here [T] COG2200 FOG: EAL domain ... can be seen here     ..................................................................................................................