                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:93 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -7.20 kcal/mol
Antiterminator: Size=48 nt.     Delta G=-11.70 kcal/mol
Anti-antiterminator:   Size=76 nt.     Delta G=-29.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCAGGCGGCGAAATAGgctgaagacggcggtgttgggaaagggcgtcataccacactcggcgtcatcctcgggcttgtcccgaggatc
tgcaacgtgtcggtttacgtgacgtggttagatccttgggacaagcccaaggatgacggaagcggggtgttgcggtctcaccaatcccgggtttgagcat
gaagcgcctgccctctttttcatccttggatctgatatttgacgatgttcaaaatagcgcgatccgctgataaatattgctttgcgtccgccgtcgctgt
atttcagcgcccATG

    Atu4491 Gene: Atu4491     GI: 17938180     BI number: Atu4491     GOG: COG1054     Description: conserved hypothetical protei   a c  a a  g gc gc gc ta ta cg cg ta at g  g a  | t  | t  | g  | g  |        t t  |      c  c g  |      t  a c  |       gc a  |       gc g  |      c  a ta       g  | gc       t  | cg       t  | a  |      g  | tg        ta ta        gt ta        gc g  g       gc gc        gc         g cg        cg       t  a tg       g  g      a  a g  g      a  g       cg t  g       at        gc gt        gt       a  g cg        gt       g  c at        cg       t  c at       |  a      t  t cg       a  g       tg gc        gc        gc tg        ta        gc cg        at        gc                         tctttttcatccttggatctgatatttgacgatgttcaaaatagcgcgatccgctgataaatattgctttgcgtccgccgtcgctgtatttcagcgcccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1054 Predicted sulfurtransferase ... can be seen here     ..................................................................................................................