                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:74 nt.     Distance to run of Ts=3 nt.   Size=33 nt.     Delta G=-17.60 kcal/mol
Antiterminator: Size=14 nt.     Delta G= -4.30 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G= -5.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGCCTTCAGGCCGCCCGCGACCAAAGCGCGCGCCAGGGGAACGGCGGAAGCGGCATCA
TCCACGATCAGCACCGGCACGACCGGCTGCAGTTTGAGGATGGAGAGAAGTTTTTCGG
AATCCTGGGCCAAgacgagcctccttgcgcgattgaaacgattgaaatcccgtttaccgattagcctgccccggctttgatgtcgaggcat
ggcggggccattttttatccagatacttcaatcaattcgcttcttcatgaagctctcttgcgataatctgaccccccagtttgcggagacagcATG

    Atu4493 --- Atu4492 Gene: Atu4493     GI: 17938182     BI number: Atu4493     GOG: COG2954     Description: conserved hypothetical protein Gene: Atu4492     GI: 17938181     BI number: Atu4492     GOG: NOG07129     Description: conserved hypothetical protei aa g  a t  t t  c a  c                 tg gc                 a  t cg                  gc at                  tg at                  ta at                  tg |  a                 cg |  c                 gc gc                 g  a tg                 c  t ta        cc       c  | at       g  c       cg gt       t  c       cg c  a       cg        gc g  |       cg        tg cg        gc        cg gc        at        cg                         gccattttttatccagatacttcaatcaattcgcttcttcatgaagctctcttgcgataatctgaccccccagtttgcggagacagcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2954 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................