                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:77 nt.     Distance to run of Ts=2 nt.   Size=37 nt.     Delta G=-14.60 kcal/mol
Antiterminator: Size=32 nt.     Delta G= -4.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCCTGAGAGCCTGTGAtggtttgatagattccatcataaacccggcgcctgtttctatcatgcttgatggttttgcgtgctgttgacg
cgttgacgccgcgcccggactaggaaatcttggccgcctgtggagcgggcaggaggccgaccttcacgacactagattatttcagggttgcttgacgccg
cggattttcctttgcggcgaaggggtagctttttgccggaaagccatgacagcgcgaaatgcgcgagagggcgcaaccggttcttttcaaaaggtttttg
gaggagaacgacATG

    Atu4551 Gene: Atu4551     GI: 17938240     BI number: Atu4551     GOG: COG1879     Description: ABC transporter, substrate binding protei            tt   a       t  c t  t      t  c t  t       at at        gt gc        gt a  a       cg tg        gc cg        cg a  |       cg cg        gc at        cg gt       |  a cg       a  a |  c      g  g |  t       tg at        tg cg        cg ta        gt             agctttttgccggaaagccatgacagcgcgaaatgcgcgagagggcgcaaccggttcttttcaaaaggtttttggaggagaacgacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1879 ABC-type sugar transport system, periplasmic component ... can be seen here     ..................................................................................................................