                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:39 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-15.70 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -8.57 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G= -6.86 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACCAGACCTACAAGGTTCTGGAAGACGATGTCGCCAAGATCAACGAGGCGGTTGCGGT
CAAGAAATAAtcggcacTCATCGGCCTTGCCGGAAGAATTCGGCCATCGAAGACCATGCCC
GGAGGCTCTCTCCGGGCATATCCATCCCCTCCTTGCGAGCGGATATCGCCGCATATGC
TGCCTCGATCAGCCCCATCGAAAAACTGAAATAAGCGCCGTTTAAACCTGATGACGAG
GCGCGCGGAAAACCGCGTCGCCTGTTTTCGTCACGCGTCATtcgcttaaaatcataggattcgtcATG

    Atu4566 Gene: Atu4566     GI: 17938255     BI number: Atu4566     GOG: COG0671,COG1404     Description: serine proteas   C G  C A  C C  C TA AT        CT GC       C  G CG       A  A TA       A  T |  A      A  G |  A      T  A |  A      T  C C  A      T  G C  C      G  A G  T       CG T  G       CG C  A       GC        AA G  A       CG       A  A TA        GC        GC AT       A  G       GC TA       A  |       CG A  A      T  |       GC CG       A  |       CG GC       A  |      |  T CG       A  |       GC C  C       GC        CG GC        TG        GC CG        CG        GC                         TGTTTTCGTCACGCGTCATtcgcttaaaatcataggattcgtcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG0671 Membrane-associated phospholipid phosphatase ... can be seen here [O] COG1404 Subtilisin-like serine proteases ... can be seen here     ..................................................................................................................