                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:36 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-25.20 kcal/mol
Antiterminator: Size=23 nt.     Delta G= -6.50 kcal/mol
Anti-antiterminator:   Size=70 nt.     Delta G=-18.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TATCAGCGGCGGCAAGCTGTCCTTCATGGAAACCTTCCCCGATGAAGGCGATATGGAC
ATGGTGCGCTCGCTGAAGCTCTATCACGAACTCGGCTATCGCTACATGATCATGCCTG
ACCATGTGCCGACGATCGCCGGCCGTGATCCTGTCGGTGTCGCTTTCGGTTTTTGTTA
CGGCTACATCGCAGCGCTTATCGAAGCGCTGGATAACAAACATCTCTGActttttgggtcggtg
gcgctgcgcagtgccgccggcctttttccatcttgaatgaccgatctgtaggaggagcaggtATG

    Atu4626 Gene: Atu4626     GI: 17938315     BI number: Atu4626     GOG: COG0747     Description: ABC transporter, substrate binding protein [oligopeptide TC A  G TA TA CG GC CG GC AT CG G  | CG TA A  | C  | A  | T  | C  | G  | G  | C  | AT TA TA GC TA TA                  cg TA                 g  c T  C                 ta TA         t        cg GT       t  t       gt GC       t  g       cg C  T       tg        gc T  C       cg        gc T  |       At        tg T  |       Gc        gc C  |       Tg        gc GT        Cg        cg CG       T  t       tg TA        Cg        gc Gc        Tg        gc                         tttttccatcttgaatgaccgatctgtaggaggagcaggtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0747 ABC-type dipeptide transport system, periplasmic component ... can be seen here     ..................................................................................................................