Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:124 nt.     Distance to run of Ts=3 nt.   Size=24 nt.     Delta G= -8.80 kcal/mol
Antiterminator: Size=48 nt.     Delta G=-13.35 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-20.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTCCGCTGGTCCGGGAGGTAACGAGGAGGATTTCGATAGTCCCGCCATCGGCATAACG
GAAGCAGAGCGCGGCATATTGCTGCCGGAAAGCGCCGGTGAAGAGCTTTTCCGGAACA
GCAGCCAGCTGCTGAAGCAATGTGAGTGGACGGGCCGGGCGGGTCTTCCGGCGTTTCT
TGGCGGGTTTCATatccgttgatagtgccgattttccgggttgcatcaatgccccgcgtgcatttatgacagttttatgacaatcaccccc
cacaactaataaagcgccattgagggccaattcgcATG

    Atu4634 --- pit*


Gene: Atu4634     GI: 17938323     BI number: Atu4634     GOG: COG1392     Description: conserved hypothetical protein
Gene: pit*     GI: 17938322     BI number: Atu4633     GOG: COG0306     Description: phosphate permease (N-terminal


           CA
          C  G
           GC
  T        AT
G  G       CG
G  A       GC
C  A       AT
C  G       CG
G  A      |  A
 CG       |  A
 GC       |  G
|  T      |  C
 AT       |  A
 AT       |  A
 AT       |  T
 GC       |  G
 GC       |  T
 CG       |  G
 CG       |  A
|  A      |  G
|  A      |  T        G
 GC       |  G      G  C
 TA       |  G      G  G
 CG       |  A       CG
 GC       |  C       CG
 TA       |  G       GT
T  |      A  G       GC
A  |      A  G       GT
T  |       GC       C  |
A  |       GC        AT
 CG        CG        GC
 GC        CG        GC
 GC        TG        TG
                        GCGTTTCTTGGCGGGTTTCATatccgttgatagtgccgattttccgggttgcatcaatgccccgcgtgcatttatgacagttttatgacaatcaccccccacaactaataaagcgccattgagggccaattcgcATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[P] COG1392 Phosphate transport regulator (distant homolog of PhoU) ... can be seen here
[P] COG0306 Phosphate/sulphate permeases ... can be seen here

    ..................................................................................................................