                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:25 nt.     Distance to run of Ts=0 nt.   Size=17 nt.     Delta G= -6.40 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -3.40 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G= -5.44 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGCGTCTTGACGTCGGCTTCATAGCCCAGCGCATCGAGCAGGACGGAGGCGACGCCAT
TGGTCGCGGTAATGTCTGTCCAGCCGGGATCGCTGAGACGAATCGTCCTGCAGGCCGC
GTCGTCGGCCGCCTGAAGCGGGGTGGAGAAGGCTGCCACGGACAGAATGAGACCGGCG
GCGATGCGATGCAGATGAGAAACGGATTTCATtgcggctccccttttattagtccagtttattgaacaccacattg
tttttgcctgtgaagcgggtatttttcgatggttgatataaggaattttaATG

    Atu4646 Gene: Atu4646     GI: 17938335     BI number: Atu4646     GOG: COG0583     Description: transcriptional regulator, LysR famil tc c  c gc gc c  t g  t t  t       ac T  t      c  a A  a      c  t C  t       at T  t       cg Ta        at Tg        at At        gt Gc       t  t Gc       t  t C  a      a  g A  g      t  c        a A  |      t  |      g  a A  |      t  |      t  g Gt        gc        gc At        at        tg Gt        cg        cg Ta       |  t       cg At        cg        gt Gt        ta        ta                         tttttcgatggttgatataaggaattttaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0583 Transcriptional regulator ... can be seen here     ..................................................................................................................