                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:110 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-17.20 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -8.45 kcal/mol
Anti-antiterminator:   Size=12 nt.     Delta G= -4.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGCGTAACTAAgggcgctttcgcagcgtcacggaactatgggaagaatgacggtgcgatacattcttctcccgccggggagcagaacaagag
gcctgctcctctttcttgggataaatcgaacctcccggcgcccacgccacaaaccgaacgattaaaagccgccgcgggtaatttccgcgacggctttttg
gttgttcttgaacaattattccgccattcgagaaagcgaagcggccgcgcggcgttgataacgaaaaaatataatagtactctttatgtcgacaagaggg
atttggtgATG

    Atu4674 Gene: Atu4674     GI: 17938363     BI number: Atu4674     GOG: COG1802     Description: transcriptional regulator, GntR famil            aa           g  c           c  g           c  a           a  t           a  t           a  a           c  a           a  a           c  a            cg            gc           c  |        a           a  |      a  t           c  |      t  t           c  |       gt           c  |       gc            gc        gc            cg        cg            gc        gc cc        gc        cg c  a       cg       c  a gc       |  c       gc cg        cg        cg gc        cg        cg gc        tg        gc                         tttttggttgttcttgaacaattattccgccattcgagaaagcgaagcggccgcgcggcgttgataacgaaaaaatataatagtactctttatgtcgacaagagggatttggtgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1802 Transcriptional regulators ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:193 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-14.00 kcal/mol Antiterminator: Size=12 nt.     Delta G= -4.50 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TGCGTAACTAAgggcgctttcgcagcgtcacggaactatgggaagaatgacggtgcgatacattcttctcccgccggggagcagaacaagag gcctgctcctctttcttgggataaatcgaacctcccggcgcccacgccacaaaccgaacgattaaaagccgccgcgggtaatttccgcgacggctttttg gttgttcttgaacaattattccgccattcgagaaagcgaagcggccgcgcggcgttgataacgaaaaaatataatagtactctttatgtcgacaagaggg atttggtgATG     Atu4674 Gene: Atu4674     GI: 17938363     BI number: Atu4674     GOG: COG1802     Description: transcriptional regulator, GntR famil            ag           a  a           c  g           a  g           a  c            gc            at            cg cc        gc g  g       at cg        gc cg        gc cg        gt ta        gc             tttcttgggataaatcgaacctcccggcgcccacgccacaaaccgaacgattaaaagccgccgcgggtaatttccgcgacggctttttggttgttcttgaacaattattccgccattcgagaaagcgaagcggccgcgcggcgttgataacgaaaaaatataatagtactctttatgtcgacaagagggatttggtgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1802 Transcriptional regulators ... can be seen here     ..................................................................................................................