                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:165 nt.     Distance to run of Ts=2 nt.   Size=29 nt.     Delta G=-21.10 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -8.20 kcal/mol
Anti-antiterminator:   Size=20 nt.     Delta G= -4.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGGCGATGCTCGCCAAGGTCAAGAGCGTCGACTTCCGCGCCGACAATAAGCCGCGCCA
TTGGCTGACCCAGCTCGATAAATAAgacggattgcaagtgaggcgccggtcattcgaccgagcgccttggttgttttcagca
ggcatccgtctggcagcgcgatgatctgcgtcagaaattgtcgacaaagttgcaacggtttcgtggttcttgcatggcgcgtaacccatggcccgtctct
ggaagagaatgatcgaacctgcatgcccgcgtggctcaggctcgcgtccgagaggtaacaATG

    Atu4696 --- Atu4697 --- Atu4698 --- trzA --- Atu4700 --- Atu4701 Gene: Atu4696     GI: 17938385     BI number: Atu4696     GOG: COG0601     Description: ABC transporter, membrane spanning protein [oligopeptide] Gene: Atu4697     GI: 17938386     BI number: Atu4697     GOG: COG1173     Description: ABC transporter, membrane spanning protein [oligopeptide] Gene: Atu4698     GI: 17938387     BI number: Atu4698     GOG: COG0402     Description: hydrolase Gene: trzA     GI: 17938388     BI number: Atu4699     GOG: COG0402     Description: N-ethylammeline chlorohydrolase Gene: Atu4700     GI: 17938389     BI number: Atu4700     GOG: COG0444     Description: ABC transporter, nucleotide binding/ATPase protein [oligopeptide] Gene: Atu4701     GI: 17938390     BI number: Atu4701     GOG: COG4608     Description: ABC transporter, nucleotide binding/ATPase protein [oligopeptide            cg           a  g           g  a            At            At            Tg           A  c           A  a           A  a           T  g           A  |       tt            Gt       a  c            Cg        cg            Ta        ta   C       |  g       gc A  C       Cg        gc GC        Gc        cg TA       |  g      |  a CG       A  c       cg GC       C  c       gc |  T       Cg        cg GC        Cg        gc TG        At        gc TA        Gc        at AT        Ta        gt                         ggttgttttcagcaggcatccgtctggcagcgcgatgatctgcgtcagaaattgtcgacaaagttgcaacggtttcgtggttcttgcatggcgcgtaacccatggcccgtctctggaagagaatgatcgaacctgcatgcccgcgtggctcaggctcgcgtccgagaggtaacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [EP] COG0601 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here [EP] COG1173 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here [FR] COG0402 Cytosine deaminase and related metal-dependent hydrolases ... can be seen here [FR] COG0402 Cytosine deaminase and related metal-dependent hydrolases ... can be seen here [EP] COG0444 ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component ... can be seen here [E] COG4608 ABC-type oligopeptide transport system, ATPase component ... can be seen here     ..................................................................................................................