                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:136 nt.     Distance to run of Ts=1 nt.   Size=27 nt.     Delta G=-10.10 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -6.30 kcal/mol
Anti-antiterminator:   Size=76 nt.     Delta G=-25.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGCAAGCGCGTAGTTGGAGTTGTCGTTGGGACCCGCCGTCAATGCCGCACCATTTCTG
TGAACCAATCGTGTATTGGTTCATTTGCGGAGAAATTCGGGTGCAGGTCAAGCGTATT
TTTGAACCATAATTTTTGGTGCTCAAAACATGGGCACGAAGCATTTTTCAAAGGCTGC
GCGCGGCTTTCATCTGCACGTTCTAGAACAGGGAACCCGACAACAAACGTTCCCTCCG
CAACACGCTGCAAcacttggcgaaaccatgcgttatagtctcgcagatcatgagatgccgggggcgatATG

    Atu4716 Gene: Atu4716     GI: 17938405     BI number: Atu4716     GOG: COG2202,COG2771     Description: transcriptional regulator, LuxR famil   T G  G C  T TA AT AT CG CG AT AT GC |  A |  T |  T |  T TG GC TG        TA CG       G  T TA       C  T TG        GT TA        AT |  A       AT |  A       CG |  T      |  A |  T       TA |  C       GC A  G       GC CG       |  A CG       |  T AT       |  A        A CG       |  A      A  C GC       |  T      A  A |  A      |  T       AT CG       |  T       CG CG       |  T       TG GT       |  T       CG T  C      A  G       GC A  A       CG        TA A  A       GT        GC C  |       TG       G  G TG        GC        TA GC        GT        TA CG        GC        TG                         CATTTTTCAAAGGCTGCGCGCGGCTTTCATCTGCACGTTCTAGAACAGGGAACCCGACAACAAACGTTCCCTCCGCAACACGCTGCAAcacttggcgaaaccatgcgttatagtctcgcagatcatgagatgccgggggcgatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG2202 FOG: PAS/PAC domain ... can be seen here [K] COG2771 DNA-binding HTH domain-containing proteins ... can be seen here     ..................................................................................................................