                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:86 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-11.20 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -9.34 kcal/mol
Anti-antiterminator:   Size=30 nt.     Delta G=-21.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GACAAGGGCAGGATTGTCGAGGAGGGCGACCATCAGGCGCTGATCCGCCTCCATGACG
GCATCTACCGCCGGCTGTTCGAGCGGCAGGCGCTGGAACTGACCAAGGGCCTGGTGGC
CTGAaaaaaagaaatgccgggggcatcctcccggcgtttccttcggaacattgaacccacgccatgaacgcgccgctttgttcgcgtaagggcgttt
tctccgcaataccaacaggatggtgcatcatggatttcaacccgatcacaaagccgcaacgccttgtcatcaggagaacccatatccATG

    Atu4729 Gene: Atu4729     GI: 17938418     BI number: Atu4729     GOG: COG0488     Description: ABC transporter, nucleotide binding/ATPase protei            tg           t  a           a  a           c  c           a  c           a  c       tt           g  a      c  t            gc       g  g at        cg       c  t c  c      |  c      c  t gc       t  c       gc gt       t  a       cg gc       c  t       gc gc        cg        cg gc        ta        at cg        ta       a  a cg       |  c      g  a gc        tg       t  g tg        gc       a  | at        cg        cg at        gc        cg at        gc        gc gc        cg        cg                         ttttctccgcaataccaacaggatggtgcatcatggatttcaacccgatcacaaagccgcaacgccttgtcatcaggagaacccatatccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0488 ATPase components of ABC transporters with duplicated ATPase domains ... can be seen here     ..................................................................................................................