                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:97 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-18.70 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -6.30 kcal/mol
Anti-antiterminator:   Size=32 nt.     Delta G=-13.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGAGACCTCAACGCCGCCGCCGGACGGTCGCAGCTGCTAAGCTCGGTGACGCTCGAT
GCGAAGGGAGCCCGCTACAAGGCGGTGCTCGATCTCGTGATCGACGGGAAGAGCTTCA
CTTGCACGAAGCAGATTGGCGGCGATTAAgtcgccgcacactatcaattttcacctgagagggcgccgtttctggcgcc
cttttcttttgcgcgcgccgagtgactgaacgcgatgtgaatgggtaattccggtcgggttcagttgccggatgcgattatggatcatcggcaaggcgct
gacagATG

    Atu4766 Gene: Atu4766     GI: 17938455     BI number: Atu4766     GOG: -------     Description: hypothetical protei             t           t  c   A       t  a T  A      t  c Tg       a  c At        at Gc        cg Cg        ta        tt Gc       a  g      t  c Gc        ta        gt Cg        cg        cg Gc       a  g       cg |  a      c  |       gc Gc       a  |       cg Ta        cg        gc |  c       gc        gc |  t       cg        gc Ta       c  c       at At        gc        gt Gc        cg        at                         tcttttgcgcgcgccgagtgactgaacgcgatgtgaatgggtaattccggtcgggttcagttgccggatgcgattatggatcatcggcaaggcgctgacagATG     ..................................................................................................................