Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:114 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-21.40 kcal/mol
Antiterminator: Size=38 nt.     Delta G=-16.00 kcal/mol
Anti-antiterminator:   Size=28 nt.     Delta G= -9.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gtacagtccacccgatacctaagtgtagtttcggcaaggcctggcctgcgataatttctgcctgtcgccccgccccagggcgattggctcgcagaagcca
gaaactccggcgtcccctccccggagccgcggatctccctcccgatccgccaaggccgcccccgccgcaggaggcggccttttttttcattttggccgcg
ggaacgcaggcaacctatgcctgagtattatgtttactccttcgcagttgcgttagcgtcatgactatcgtcaatccgcacaatcgaaggaacctctgac
ATG

    fdhF_lrep_1


Gene: fdhF_lrep_1     GI: 17938465     BI number: Atu4708     GOG: COG0243     Description: formate dehydrogenase alpha subuni


           ct
          c  c
          c  c
          t  c
           cg
           ta
  c        at        cg
t  c       gc       c  c
c  c       gc       g  a
c  c       cg        cg
 cg        gc        cg
 cg       |  c      c  a
 ta       |  a       cg
g  |      |  a       cg
 cg        cg        gc
 gc        cg        cg
 gc        gc        cg
 cg       |  c       gc
c  c      a  g       gc
 tg        gc        at
 cg        gc        at
                        ttttttcattttggccgcgggaacgcaggcaacctatgcctgagtattatgtttactccttcgcagttgcgttagcgtcatgactatcgtcaatccgcacaatcgaaggaacctctgacATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[C] COG0243 Anaerobic dehydrogenases, typically selenocysteine-containing ... can be seen here

    ..................................................................................................................