                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:190 nt.     Distance to run of Ts=1 nt.   Size=24 nt.     Delta G= -9.10 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -7.80 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G=-12.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ggttccaggcaatggcgtgccgcagaagatcgcagacgtccagctatgccagcgcagccagcgcgcgatccaagtcaaccgcctcctgccattcattggc
tggcattttatggatcttctaacccataagggcgtcatctgcgtttcggctaccaaaaggatagtaaggcgccaacttgggagtatttgccactccgtat
cgtgagcccactagtccttacgaccagcttgccgctcgttttcacctcgccaagaatgcttcttcagacggcgcacttggaggaaggaaaaagcgtgagg
ATG

    bme8 --- bme7 --- bme6 Gene: bme8     GI: 17938506     BI number: Atu4817     GOG: COG0438     Description: glycosyltransferase Gene: bme7     GI: 17938505     BI number: Atu4816     GOG: COG0438     Description: glycosyltransferase Gene: bme6     GI: 17938504     BI number: Atu4815     GOG: COG0438     Description: glycosyltransferas ca c  g gc tg a  c ta        ca cg       c  a gc        tg a  c       at c  a       gc         c c  |      c  a      t  a tg       g  a      t  t gc       c  c       at cg        gc        cg a  c       cg        cg g  |       gc        gc a  |      a  c      t  t cg       c  t      c  | gc       c  c      c  | cg        gc       t  | ta        at        cg at        cg        cg gc        gc        gc                         attttatggatcttctaacccataagggcgtcatctgcgtttcggctaccaaaaggatagtaaggcgccaacttgggagtatttgccactccgtatcgtgagcccactagtccttacgaccagcttgccgctcgttttcacctcgccaagaatgcttcttcagacggcgcacttggaggaaggaaaaagcgtgaggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0438 Glycosyltransferase ... can be seen here [M] COG0438 Glycosyltransferase ... can be seen here [M] COG0438 Glycosyltransferase ... can be seen here     ..................................................................................................................