                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:206 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -7.20 kcal/mol
Antiterminator: Size=28 nt.     Delta G= -7.44 kcal/mol
Anti-antiterminator:   Size=30 nt.     Delta G= -4.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATATCTTTCGCCCGGATTAAAGACCCATTTACTCCCCCATCCGGTTGCATCAAAAGGA
ATCTTTGCGGCCCTCAGCTCCTTGACTAGGGCTTGTTTCCAGCCTTCGGCAGCGTCCA
TTTCCGTATAGACGATGCCAAAGAGATCAGATGGAATTTCGACATTACACTTCCGAAA
TAGGCAGACCCGCCCTCTTCCCAGCTTTCCCGCAAAATTGCCAAGCTCAAAAATgacatt
ctgccttgcgcgttggctctggccctcggcagataccgtcgatccaatctttggccccggagcagaATG

    Atu4828 Gene: Atu4828     GI: 17938517     BI number: Atu4828     GOG: -------     Description: hypothetical protei cg c  g c  a       GG cg       A  A gc       A  A       CT |  a      A  T      C  T |  g      A  C      T  G g  a      C  T      C  A t  A      T  T       GC t  T       AT        AT tG        CG       C  | cG        GC        TA tG        TG        CG aT        TG        CG aT        GC        CG cG        GC        GC                         TTGTTTCCAGCCTTCGGCAGCGTCCATTTCCGTATAGACGATGCCAAAGAGATCAGATGGAATTTCGACATTACACTTCCGAAATAGGCAGACCCGCCCTCTTCCCAGCTTTCCCGCAAAATTGCCAAGCTCAAAAATgacattctgccttgcgcgttggctctggccctcggcagataccgtcgatccaatctttggccccggagcagaATG     ..................................................................................................................