                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_pl-AT

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:14 nt.     Distance to run of Ts=2 nt.   Size=28 nt.     Delta G=-22.00 kcal/mol
Antiterminator: Size=72 nt.     Delta G=-26.50 kcal/mol
Anti-antiterminator:   Size=33 nt.     Delta G=-12.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCCTCGATTTCGAGGCGGCAAAAGACTACTCCGCCCGCTATCCGGCGCTGAAGATTG
CAGTCAACATTCCAAGCTTCGATGCGCCTGCCGGCTTCGTCATCCGCAAGGGGAACGA
TGCATTGCGCAACGCACTGGACAAGGGCCTGAAAGAGGCCATGCAGGACGGCACCTGG
AAGAAGCTTCATGAAAAATGGTTCCCCGGCACACCGATGCCGGCGGCATATCTTCCCA
AGCAGTGAtgccgccttccggtccggcctccaccggtcgggccggcctttctttcaagggatatactgATG

    glnP/glnQ --- Atu5004 --- agaE Gene: glnP/glnQ     GI: 17938594     BI number: Atu5005     GOG: -------     Description: ABC transporter, nucleotide binding/ATPase protein [glutamine] Gene: Atu5004     GI: 17938593     BI number: Atu5004     GOG: COG0673     Description: NAD binding oxidoreductase Gene: agaE     GI: 17938592     BI number: Atu5003     GOG: COG0665     Description: santhopine deaminating protei            CA           C  A           C  G           T  C            TA            CG           T  T           A  G            TA            At            Cg            Gc            Gc            Cg            Gc            Gc           C  t           C  t           G  c           T  |           A  | CC        Gc A  G       Cg C  A       Cg AT        At CG       C  |       ca GC       A  |      c  c GC       C  |      t  c CG        Gc        cg CG        Gc        cg |  C       Cg        gt CG        Cg        gc CG       C  c       cg |  C      C  c       cg |  A      T  t       tg T  T      T  |       gc TA        Gc        gc GT        Gc        cg GC        Ta        cg                         cctttctttcaagggatatactgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0673 Predicted dehydrogenases and related proteins ... can be seen here [E] COG0665 Glycine/D-amino acid oxidases (deaminating) ... can be seen here     ..................................................................................................................