Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_pl-AT

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:33 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-12.50 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-18.50 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G= -6.37 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cggctgtcggagaagcttgtcgagcggctggaaaagatggaactggtcgaggagagctccatccgcggtgaaccggtgctacagttgaccactgtcggac
aggcgatcaaggcgcagctgcttcaataatctgtctgcgccggctttgcatccgttggaaagacatccacctcaccacatgaaagcctaaccgggcgacg
ctactgaccaatgttttgatataaaaattggtcagtaacgcgggagttgccatcgtgaccaatttttgtatataatttttggacacaatgtaggacaact
ATG

    Atu5045 --- Atu5044


Gene: Atu5045     GI: 17938633     BI number: Atu5045     GOG: -------     Description: conserved hypothetical protein
Gene: Atu5044     GI: 17938632     BI number: Atu5044     GOG: NOG08233     Description: conserved hypothetical protei


 ac
a  c
 tg
 cg
 cg
 gc
a  g       at
a  a      g  a
a  c      t  t
g  g       ta        gg
t  c       ta       c  g
a  t       ta       g  a
c  a      g  a       cg
a  c       ta        at
c  |       at        at
c  |       at        tg
 at        cg        gc
 cg        cg       |  c
 ta        at       |  a
c  c       gc       |  t
c  c       ta       |  c
a  a       cg       |  g
c  |       at        at
c  |       ta        cg
 ta       c  a       ta
 at        gc        gc
 cg        cg        gc
 at       a  |       ta
 gt        gc        ta
 at        cg        at
                        ttttgtatataatttttggacacaatgtaggacaactATG


    ..................................................................................................................