                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_pl-AT

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:89 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -6.10 kcal/mol
Antiterminator: Size=42 nt.     Delta G=-14.90 kcal/mol
Anti-antiterminator:   Size=41 nt.     Delta G=-15.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cccgcgttactgaccaatttttatatcaaaacattggtcagtagcgtcgcccggttaggctttcatgtggtgaggtggatgtctttccaacggatgcaaa
gccggcgcagacagattattgaagcagctgcgccttgatcgcctgtccgacagtggtcaactgtagcaccggttcaccgcggatggagctctcctcgacc
agttccatcttttccagccgctcgacaagcttctccgacagccgcttgtcacctaccagccaacccctgcccactttcctctgtcgccggaagaaagcaa
TTG

    Atu5046 Gene: Atu5046     GI: 17938634     BI number: Atu5046     GOG: -------     Description: hypothetical protei   c c  g       gc t  a      a  a gc       t  c ta        gc c  |       tg cg        cg gt        at cg        at tg       c  c at        ta        tc gc        gc       c  g ta        gc       c  a ta        tg       t  c c  c       gc       c  c c  |      a  g       ta gt       c  g       cg cg       a  a       gt gt        gt        at ta        cg        gc cg        cg        gc gc        ta        ta                         tcttttccagccgctcgacaagcttctccgacagccgcttgtcacctaccagccaacccctgcccactttcctctgtcgccggaagaaagcaaTTG     ..................................................................................................................