Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_pl-AT

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:86 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G= -8.30 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -3.60 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-12.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGCAACTCTTCGACCTGTCAGCGGACCTTGTCGGTCTGGCTGATCGGGATACCGGGT
TCAGGCTGCCGGCGGGGCGGGGCGACGAGTTTGCCCACGGCGGCGGCGGGCCTGATTC
GCGTGATCGACAAAAGCCTGTTGTCCCGCGGGACATGTTCACACCCGATCTCCATATA
GATACGCTGAAGATAAAAAGTCGGAATTTTCAGTGAtttttcgctatcccgggagccgcgccgcttggcgtcc
ctcgagggcccccgcagcatttttttggaaaacagtagagttggcgtgcagccATG

    Atu5101


Gene: Atu5101     GI: 17938687     BI number: Atu5101     GOG: -------     Description: conserved hypothetical protei


 TC
G  C
T  C
 TG
 GC
 TG
 CG
 CG
G  A       AT
A  C      C  A
A  A      C  T
A  |       TA
 AT        CG
 CG        TA         G
 AT        AT       A  T
 GT       |  A      A  C
C  C       GC       A  G
T  A       CG       A  G
A  |      C  C      A  A
 GC       C  |       TA
 TA       A  |       AT
 GC       C  |       GT
C  C       AT        AT
 GC        CG        AT
 CG        TA        GC
T  |       TA        TA
 TA       G  G       CG
 AT        TA        GT
 GC        AT        CG
                        AtttttcgctatcccgggagccgcgccgcttggcgtccctcgagggcccccgcagcatttttttggaaaacagtagagttggcgtgcagccATG


    ..................................................................................................................