Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_pl-AT
Characteristics of the secondary structures
Terminator: Distance to gene:50 nt. Distance to run of Ts=0 nt. Size=32 nt. Delta G=-21.40 kcal/mol
Antiterminator: Size=45 nt. Delta G=-11.50 kcal/mol
Anti-antiterminator: Size=44 nt. Delta G=-10.40 kcal/mol
Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
GGAAGTGAAGTCCTTCGTCGAAAACATGTCTTTCCCTCTGTCGACATGGTCGAGCTGG
GAGCAGGCGATTAGCCAGAAGGGCGGCAGTGACGCAACGGTTCGTGGCCTTTCGGATG
CGTGGCTGAGTGAGAACAAGGCTCTGCTTGACGGTTGGATTACGGCGGCCAAATCCGC
GAATTAAacctaagccgattgagttactataccaagtatgaatggcggaggtgcgccggaacctccgccgtttttcttgagttttccaattatca
gatgaaagcgcagagttttctgcggattaagATG
Atu5221
Gene: Atu5221 GI: 17938806 BI number: Atu5221 GOG: ------- Description: conserved hypothetical protei
AA ac
C A t c
C T a a
GC ta
GC cg
CG at
GC ta
| G t t
| A g | cc
G A a | g g
C T g | c g
AT tg g a
TA ta ta
TA a a gc
A a gt gc
Gc cg at
Gc cg gc
| t gc gc
| a a g cg
Ta a g gc
Tg ta gc
Gc cg tg
Gc cg at
Cg at at
tttcttgagttttccaattatcagatgaaagcgcagagttttctgcggattaagATG
..................................................................................................................