Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_pl-AT

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:65 nt.     Distance to run of Ts=2 nt.   Size=14 nt.     Delta G= -8.00 kcal/mol
Antiterminator: Size=37 nt.     Delta G=-14.60 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-18.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTTCGAAGACCGGGATCAGGTGCGCTGCCTGATAGAGATCATCGATGAACTTCCAGAA
CGCCAGCGCAAAATGCTGGTTGCTTGCCGGCTCGACCAGCGCCGCCATGCCGATATTG
CCGCAGAATTTGGGGTCTCGATCCGCACGGTCGAGCTGGAAGTCCGCAAGGCAGTCGA
CTATTGCAGGGAGCGGCTCGAAACAATAAATCGAGCCTGAagcttcggcttctcatttttcaatcgttga
tagttttagaaacaggtataggcagcatcctgtaacgaacacgtataagggagcggATG

    Atu5310


Gene: Atu5310     GI: 17938894     BI number: Atu5310     GOG: COG3712     Description: transmembrane senso


 CG
T  A
 GC
 AT
C  A
G  |
G  |        A
 AT       A  T
 AT       C  A
 CG       A  A
 GC       A  A
|  A       AT
 CG        GC
 CG        CG
 TG        TA
G  A       CG
A  G       GC
A  |       GC
G  |      |  T
 GC       |  G
 TG       |  A       tc
 CG       |  a      t  g
 GC        Cg        cg
 AT        Gc        gc
 GC        At        at
 CG        Gt        At
 TA        Gc        Gc
                        tcatttttcaatcgttgatagttttagaaacaggtataggcagcatcctgtaacgaacacgtataagggagcggATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[PT] COG3712 Fe2+-dicitrate sensor, membrane component ... can be seen here

    ..................................................................................................................