                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_pl-AT

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:105 nt.     Distance to run of Ts=3 nt.   Size=30 nt.     Delta G= -7.90 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -9.20 kcal/mol
Anti-antiterminator:   Size=22 nt.     Delta G= -4.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTCTCGGACCTCAATCGCCATCGGCGCGGCAGGGTGGTGATTGCAAGCAGCGATCTCC
GCTCACGCCGGATGTCCGGGGTGTTTCACCTTAATCGTCCGGACGAAATCCTCGCGCA
TTTGGAAGAGACGTTGCAGGTTCGCCCCGTCAGTCTCGTTGGTGGAATCGTGCTGCTG
CGATAGccggaaattttcttcaaaaaaatcgaagaaaaaatttcgggttttcaaattcggatcgttcttcctggtagaggccgcgtcaagggatgg
cgcggcgacgactggcatggggacatcggaATG

    Atu5311 --- Atu5312 --- Atu5313 --- fepD Gene: Atu5311     GI: 17938895     BI number: Atu5311     GOG: COG1629     Description: TonB-dependent receptor Gene: Atu5312     GI: 17938896     BI number: Atu5312     GOG: COG0614     Description: ABC transporter, substrate binding protein [iron] Gene: Atu5313     GI: 17938897     BI number: Atu5313     GOG: COG2375     Description: conserved hypothetical protein Gene: fepD     GI: 17938898     BI number: Atu5314     GOG: COG0609     Description: ABC transporter, membrane spanning protein [iron             G           A  T           C  C           T  T            GC            CG        TG           |  T      C  C           C  T      G  T            CG        TG            CG        GC GT        GT        CG G  T      |  G       TA A  C       CG        AT CG        TA       A  A GC        TA       G  | T  C       GT       G  | T  C       GC        TG GC       |  G       Gc CG        AT        Gc AT        CG        Tg GC        GC        Tg                         aaattttcttcaaaaaaatcgaagaaaaaatttcgggttttcaaattcggatcgttcttcctggtagaggccgcgtcaagggatggcgcggcgacgactggcatggggacatcggaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG1629 Outer membrane receptor proteins, mostly Fe transport ... can be seen here [P] COG0614 ABC-type Fe3+-hydroxamate transport system, periplasmic component ... can be seen here [P] COG2375 Siderophore-interacting protein ... can be seen here [P] COG0609 ABC-type Fe3+-siderophore transport system, permease component ... can be seen here     ..................................................................................................................