                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_pl-AT

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:24 nt.     Distance to run of Ts=1 nt.   Size=24 nt.     Delta G=-17.40 kcal/mol
Antiterminator: Size=48 nt.     Delta G=-14.79 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G=-16.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCAAGGCAAAGTGCGAACCGGGTCCGCTGCTTCTGGGATTCGTGCTTGGACCGCTGT
TGGAAACCAATATCCGTCGGGCTCTGACGATCTCCCACGGAAATCCGAGCGTTTTTGT
GGAGCGGCCGATCAGCCTCGTCCTTCTGATCGCGACAACTGGAGTCCTTCTCCTGATG
ATCCTGCCGTCGTTCCGTAAAACCCGCGAAGAGGCCTTCCAGGAAGAAGAAGCCTAAg
gccgatcttcgatgagcggccgctggaatgcggccgttattctttccttcaaactcggtgttctccccATG

    Atu5333 --- Atu5334 --- Atu5335 Gene: Atu5333     GI: 17938917     BI number: Atu5333     GOG: COG1052     Description: 2-hydroxyacid dehydrogenase Gene: Atu5334     GI: 17938918     BI number: Atu5334     GOG: COG2379     Description: hydroxypyruvate reductase Gene: Atu5335     GI: 17938919     BI number: Atu5335     GOG: COG1304     Description: dehydrogenas            cg           t  a           t  t            cg            ta           a  g            gc   A        cg A  G       cg G  A       gc A  A       gc A  G      A  g GC       A  | GC       T  | AT       C  | C  |      C  | C  |      G  | TA       A  | TA       A  | Cg       G  |       ga Cg       A  |      g  a Gc       A  |      t  t Gc       G  |       cg |  g      A  |       gc |  a      A  |       cg At       G  |       cg Gc        Gc        gc At        At        gc At        Cg        cg Gc        Cg        gt Cg        Ta        at                         attctttccttcaaactcggtgttctccccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [CHR] COG1052 Lactate dehydrogenase and related dehydrogenases ... can be seen here [G] COG2379 Putative glycerate kinase ... can be seen here [C] COG1304 L-lactate dehydrogenase (FMN-dependent) and related alpha-hydroxy acid dehydrogenases ... can be seen here     ..................................................................................................................