Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_pl-AT

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:196 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G= -8.40 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -8.70 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-10.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tatcccaggatgctgtcgactgcgagcgattagagatctgacgccgggaaaactgacgctgagctttggccgcttgtcgtcctccagttgcaggcaggtt
tttttgcagactcgatcattccaaccccgcgttctaatagtagcacgggtctttatgatttgtgtcggcatcacgagcctcggcctggaacgaatctgaa
gagaagggcggacgcgagagcggcggaaaaaaatcacgaaactgaaagaacgtcgggaccgtgcggagccctgctggagcaggccgggtttgccatcgac
ATG

    Atu5340


Gene: Atu5340     GI: 17938924     BI number: Atu5340     GOG: -------     Description: hypothetical protei


 ga
a  t
 gc
 at
 tg
 ta         g
a  |      t  a
 gc        cg
 cg        gc
 gc       c  t
a  |       at        tc
 gc        gt       c  c
 cg        tg       c  a
|  g       cg       t  g
|  g      a  c      g  t
|  a      a  c      c  t
g  a      a  g       tg
t  a      a  |       gc
c  a       gc        ta
a  c       gt        tg
 gt        gt        cg
 cg        cg        gc
 ta       c  t      |  a
 gc        gc        cg
t  |       cg        cg
 cg        at        gt
 gc        gc        gt
                        tttttgcagactcgatcattccaaccccgcgttctaatagtagcacgggtctttatgatttgtgtcggcatcacgagcctcggcctggaacgaatctgaagagaagggcggacgcgagagcggcggaaaaaaatcacgaaactgaaagaacgtcgggaccgtgcggagccctgctggagcaggccgggtttgccatcgacATG


    ..................................................................................................................