                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_pl-AT

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:160 nt.     Distance to run of Ts=2 nt.   Size=21 nt.     Delta G= -7.20 kcal/mol
Antiterminator: Size=33 nt.     Delta G=-14.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGAATGTTGTTCGCGGCATcaaatgctcgtcaatgggccggaaagatcggctgccgtcgacccatatctccgcagatcgaagccgg
tctcgcaaagcagcgagcgttgcgatcccgtagagtcggcgatcaggtttttctcgttcgaagatgagccgccggtcagtttggctaaggtgggtgagcg
ggacgcgatcagggagcgtccgtcgcttctcggcatgaagccgtttaagcagcgcaattgccgctagaagtggagggggtgcggacgaaaacttggacca
ccaggaggtagttcATG

    tnp_lrep_1 Gene: tnp_lrep_1     GI: 17938937     BI number: Atu5025     GOG: COG2801     Description: IS3 family transposas   c g  g a  a cg gc a  g at        ga at       a  g cg       t  t gc        gc cg        cg ta        cg c  t      |  c t  c       cg gc        ta gc        at cg        gc             aggtttttctcgttcgaagatgagccgccggtcagtttggctaaggtgggtgagcgggacgcgatcagggagcgtccgtcgcttctcggcatgaagccgtttaagcagcgcaattgccgctagaagtggagggggtgcggacgaaaacttggaccaccaggaggtagttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG2801 Transposase and inactivated derivatives ... can be seen here     ..................................................................................................................