Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_pl-AT

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:199 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-10.20 kcal/mol
Antiterminator: Size=42 nt.     Delta G=-17.12 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G=-12.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATACTTCGAGACGGCGATCTGCGCAAGAAGCGCTTCCGTCGGAATGCCCGCCTCGATA
ATGTGCGCGGGTGCGGCGGCCTGAATGACGCCGTCTTCATTTTTGAAGGCATACTTCG
GTCGGCGTGTGACGATGACGCGGAACTTCGCCGGCACGACGTCAAGTCGCTCCGAGAC
GTCTTCTCCGATCAGCACCTTCTGTTTGCCGACGTGTTCGGGCAGTTCATCCGGCTCG
ATTACCACttcgacccgctcaagatgaggagcaaaacccttgcgcggtctcggcggacgcttttcagcATG

    Atu5368


Gene: Atu5368     GI: 17938952     BI number: Atu5368     GOG: -------     Description: hypothetical protei


            A
          T  A
          A  T
          G  G
          C  T
 tt       T  G
t  c      C  C
 ta        CG
 cg        GC        GA
 gc        CG       T  A
|  A       CG       C  T
c  T       CG       C  G
a  G       GT       G  A
 gC        TG        GC
 gC       A  |       CG
 cG       A  |       GC
 gT       G  |       GC
 gC        GC        CG
 cG        CG        GT
t  G       TG       T  C
c  A       GC        GT
 tA        CG        GT
 gT        CG        GC
                        ATTTTTGAAGGCATACTTCGGTCGGCGTGTGACGATGACGCGGAACTTCGCCGGCACGACGTCAAGTCGCTCCGAGACGTCTTCTCCGATCAGCACCTTCTGTTTGCCGACGTGTTCGGGCAGTTCATCCGGCTCGATTACCACttcgacccgctcaagatgaggagcaaaacccttgcgcggtctcggcggacgcttttcagcATG


    ..................................................................................................................