                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_pl-AT

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:189 nt.     Distance to run of Ts=2 nt.   Size=35 nt.     Delta G=-11.40 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -3.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TAGACCAGTAACCCCACCTCGATGAAATCAGCTTCTTTGCGTTTTGCCACTTTTGCCT
CGGATAAAGTCATttccgccacgtgttcctgtcaggagatggcgatattttgtctttgtcaaatacggaatttgcaaacacagcgcgacag
gagaaattgaatggcttccgatacagatcggtttttcgtgtcgagacgcagcgtactgctcgggagcctcgcacttgccagtgtgagcgttccggcactc
gccttctcacacacctcttccacagacggttcatcacaaggagatatcgacATG

    Atu5389 Gene: Atu5389     GI: 17938973     BI number: Atu5389     GOG: COG0596     Description: non-heme haloperoxidas GT A  C A  A       tt A  T      g  c T  t      t  c At        gt Gc        cg Gc        at Cg       c  c T  c      c  a C  |      g  | C  |       cg Gc        cg Ta        ta T  c       tg T  |       Ta T  |       At Cg        Cg At        Tg Cg        Gc             gatattttgtctttgtcaaatacggaatttgcaaacacagcgcgacaggagaaattgaatggcttccgatacagatcggtttttcgtgtcgagacgcagcgtactgctcgggagcctcgcacttgccagtgtgagcgttccggcactcgccttctcacacacctcttccacagacggttcatcacaaggagatatcgacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0596 Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) ... can be seen here     ..................................................................................................................