                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_pl-AT

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:95 nt.     Distance to run of Ts=1 nt.   Size=27 nt.     Delta G= -9.90 kcal/mol
Antiterminator: Size=32 nt.     Delta G= -6.90 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-18.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gaggccgaaacccagtacgaggtcgaacgcggcgtcgaggcctatgaacggctgaagagcaatcacggtatcgcagcctggaacccgctctcggttggca
tcgcctatgcgatgatcgaccgcatcacgcaggacaaggtgccgctcattaccatcaaccatggccgcacggattcgaccgacggtcgcgtttttcccta
tgttttcccgttgttgctcaacccctatagcgagacctccggtatcgtgaactacatcgcctccaaggaaggcggacttgagggtctgaagggcaagaag
ATT

    Atu5522 Gene: Atu5522     GI: 17939104     BI number: Atu5522     GOG: NOG10352     Description: conserved hypothetical protei ga c  c t  c a  g gc ta at gc c  a gc         t tg       a  c a  c      c  a ta       c  a       tc cg       a  c      t  g cg       t  c      a  a |  a       ta        gc |  c       at        gc |  a       cg        cg g  a      t  |      a  a cg        cg       c  | tg        gc        gc at       c  c       cg cg        cg        cg gc        gc        gt gc        ta        gc tg        gc        tg                         cgtttttccctatgttttcccgttgttgctcaacccctatagcgagacctccggtatcgtgaactacatcgcctccaaggaaggcggacttgagggtctgaagggcaagaagATT     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_pl-AT                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:105 nt.     Distance to run of Ts=1 nt.   Size=27 nt.     Delta G= -9.90 kcal/mol Antiterminator: Size=32 nt.     Delta G= -6.90 kcal/mol Anti-antiterminator:   Size=50 nt.     Delta G=-19.80 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case gaggccgaaacccagtacgaggtcgaacgcggcgtcgaggcctatgaacggctgaagagcaatcacggtatcgcagcctggaacccgctctcggttggca tcgcctatgcgatgatcgaccgcatcacgcaggacaaggtgccgctcattaccatcaaccatggccgcacggattcgaccgacggtcgcgtttttcccta tgttttcccgttgttgctcaacccctatagcgagacctccggtatcgtgaactacatcgcctccaaggaaggcggacttgagggtctgaagggcaagaag ATT     Atu5522 Gene: Atu5522     GI: 17939104     BI number: Atu5522     GOG: NOG10352     Description: conserved hypothetical protei ta c  t cg gc cg ta at cg |  a gt gc         c tg       c  g ta       g  c gc       t  t       tc gc       g  c      t  g cg       g  a      a  a |  c       at        gc |  a       at        gc |  t       ca        cg t  c      a  |      a  a c  a       gc       c  | t  c       gc        gc cg       a  a       cg gc        ct        cg c  a       gc        gt cg        ca        gc cg        aa        tg                         cgtttttccctatgttttcccgttgttgctcaacccctatagcgagacctccggtatcgtgaactacatcgcctccaaggaaggcggacttgagggtctgaagggcaagaagATT     ..................................................................................................................