                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_pl-AT

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:106 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-19.60 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -7.50 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-22.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATTCGATTATCAGTGCTGAACAGCTCTTGCGCCCTCCCCAAAAACATGATTAGtttttcat
gtgttccaaatgaacacctccgacacatcccttcgttttgcgaagccatgtgtcgctgttgcacgcggcaaaagccgtgatgcggtgatggcaagggtgc
ccgcaggctgtgacaagcctcgcgggttttttgttatctgctgacagtgacgtcagccctccaatattttcggcatgaaagcctcgccatagagccgggc
agtgccactgcgtgcgccaatcaaaaaaggggaaccaagATG

    Atu5531 Gene: Atu5531     GI: 17939113     BI number: Atu5531     GOG: COG0683     Description: ABC transporter, substrate binding protei aa a  a cg gc gc cg gt cg a  a c  t g  | t  |       gg tg       a  g       ga gc        at       t  c tg        cg       g  a cg        gc        ta gt        gc        cg cg       |  c       gc ta       |  g       gc g  |      t  c       at t  |      a  a      |  c g  |      g  g       cg t  |       tg        gc at        gc        cg cg        gt        cg cg        cg        cg gc        gt        gt                         tttttgttatctgctgacagtgacgtcagccctccaatattttcggcatgaaagcctcgccatagagccgggcagtgccactgcgtgcgccaatcaaaaaaggggaaccaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0683 ABC-type branched-chain amino acid transport systems, periplasmic component ... can be seen here     ..................................................................................................................