                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_pl-Ti

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:198 nt.     Distance to run of Ts=1 nt.   Size=28 nt.     Delta G=-13.80 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-11.50 kcal/mol
Anti-antiterminator:   Size=23 nt.     Delta G= -6.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCGGCGTTCTGCCGAGCGACGAACTCGACGACGAAGACGATCTGGAGATCGTGCATG
AATACGTTCCGGGCGGGTCTCATtgagacccttctcgcctttttggtgccgcttgcgagccgcaggcggcaagggaagcttcg
ccgctgctggcacccgggcggtggcccaaggtgcagattgtcatcttgccagccgcgcccttgcctcctttgctcttcgcgatgtccggagcgggcccgc
aaggtgcggggaaaagaaacagaaggaaaggcggacgcaagggtgcgtcgggaattcaaATG

    Atu6096 Gene: Atu6096     GI: 17939229     BI number: Atu6096     GOG: NOG10001     Description: conserved hypothetical protei            TG           A  A           C  A            GT            TA            GC            CG           T  |           A  |        T            GT       A  t            AT        Cg GG        GC        Ta T  A       GC        Cg CG        TG        Ta TA        CG        Gc AT        TG        Gc GC       |  C       Gc CG       A  G      |  t AT       G  G      C  t G  G       CG        Gc A  |       AT        Gt GC        GC        Gc TA        AT        Cg                         cctttttggtgccgcttgcgagccgcaggcggcaagggaagcttcgccgctgctggcacccgggcggtggcccaaggtgcagattgtcatcttgccagccgcgcccttgcctcctttgctcttcgcgatgtccggagcgggcccgcaaggtgcggggaaaagaaacagaaggaaaggcggacgcaagggtgcgtcgggaattcaaATG     ..................................................................................................................