Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_pl-Ti

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:69 nt.     Distance to run of Ts=0 nt.   Size=14 nt.     Delta G= -8.20 kcal/mol
Antiterminator: Size=33 nt.     Delta G=-10.00 kcal/mol
Anti-antiterminator:   Size=69 nt.     Delta G=-30.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tcggcatccgggatcagccccttggccgttctgtccttcggtttcgtggcggtctgaaccagcgcccgtccggttcaaggccgctgtcgcgccgcggggc
ggccggtcatgccgctctcgacaaaacaggcacgcgggcttcgcagaaccgtgggttccgcttgcccgcccacctgcttcgctcgatcaggcctgcccgg
accctgaaccgcccggcttgcgccggttcttttcgaccgcaccgaaggacagaacggccaaggggccgaacgcttcgggcaaaccgaaaaggaaaccatc
ATG

    Atu6109


Gene: Atu6109     GI: 17939242     BI number: Atu6109     GOG: NOG11188     Description: conserved hypothetical protei


  g
c  c
c  t
t  t
 tg
 gc
 gc
 gc
 tg
 gc
c  c
c  c
a  a
a  c
 gc
 at
 cg
 gc
c  t
t  t       ct
t  c      c  g
 cg       c  a
 gc       a  a
 gt        gc
 gc        gc
 cg        cg
|  a      c  c
|  t      c  c
g  c      g  c
c  a      t  |       tg
a  g       cg       t  c
 cg        cg        cg
 gc        gc        gc
 gc        gt        gc
 at        at        cg
 cg        cg        cg
                        ttcttttcgaccgcaccgaaggacagaacggccaaggggccgaacgcttcgggcaaaccgaaaaggaaaccatcATG
    ..................................................................................................................