Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_pl-Ti

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=3 nt.   Size=37 nt.     Delta G=-14.66 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-20.40 kcal/mol
Anti-antiterminator:   Size=59 nt.     Delta G=-20.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AACCCGCGCCGACCTCGACGCCGTTGCCGGCGGTGATGCGGAAGTCCGGAGCGTCGCG
CGAGACGCGCTCGATGGGGTTCAGGCGGGCCTTCATGCTGACTGTGAGCGTGCGCACG
TTGCCGATGATGGAGTTGTTGCCGTTGGTGTTGAATTCGCCGATGACTGCCATtgtcgtgc
tccttttccggttagctcgggccgcgcccatcgcgttctcgatgacggtgttaaggccgacggcgatcgacgccgcaccgctggcggccggaacgaagtg
gaggacggccgggagcggctttcTTG

    Atu6118


Gene: Atu6118     GI: 17939251     BI number: Atu6118     GOG: -------     Description: hypothetical protei


  t
c  c
 tg
 ta
 gt
 cg
|  a
 gc
 cg
 tg
 at
 cg
|  t       cg
|  t      a  c
|  a       gc
|  a       cg
 cg       |  c        g
 cg       t  a      a  t
|  c      a  c      a  g
 gc        gc       g  g
 cg        cg       c  a
|  a       gc       a  g
 gc        gt       a  g
 cg        cg       g  a
 cg       a  g       gc
 gc        gc        cg
|  g       cg        cg
|  a       cg        gc
 gt        gc        gc
 gc        gc        cg
 cg       a  g      g  g
 ta       a  g      g  g
|  c       ta        ta
 cg        ta        cg
 gc        gc        gc
                        ggctttcTTG
    ..................................................................................................................