                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_pl-Ti

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:167 nt.     Distance to run of Ts=1 nt.   Size=28 nt.     Delta G=-14.20 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-11.40 kcal/mol
Anti-antiterminator:   Size=20 nt.     Delta G= -6.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATTGGTTTCTCGGCATGTCGTGCGCAATCCGGTTCTGGCTGGCCACACCCACGCAGAC
CTCGATGGATCTGGTGTGACCGAAGGACGCCTTCGTCTCGATCGCCTTGGCCGCAACG
GCCATACGCGACTTTCTTCCCCTGCAAACAGGTTTGCATTCCTCGCGGGCCAAgaaagccg
ctcccggccgtcctccacttcgttccggccgccagcggtgcggcgtcgatcgccgtcggccttaacaccgtcatcgagaacgcgatgggcgcggcccgag
ctaaccggaaaaggagcacgacaATG

    tiorf76 Gene: tiorf76     GI: 17939252     BI number: Atu6119     GOG: COG5489     Description: conserved hypothetical protei             C           T  T            GC            CG            TA           T  T           C  |           C  |            GC         A            CG       C  A           A  |       GC            GC        CG   C        GC        CG A  G       AT        GC GC        AT        GC GC       G  |       TA AT        CG       |  T AT        CG       T  A GC       A  C      C  C C  |       GC        CG CG        TG        GC AT        GC        CG GC        TA        TA                         CTTTCTTCCCCTGCAAACAGGTTTGCATTCCTCGCGGGCCAAgaaagccgctcccggccgtcctccacttcgttccggccgccagcggtgcggcgtcgatcgccgtcggccttaacaccgtcatcgagaacgcgatgggcgcggcccgagctaaccggaaaaggagcacgacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG5489 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................