Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_pl-Ti

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:167 nt.     Distance to run of Ts=1 nt.   Size=28 nt.     Delta G=-14.20 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-11.40 kcal/mol
Anti-antiterminator:   Size=20 nt.     Delta G= -6.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATTGGTTTCTCGGCATGTCGTGCGCAATCCGGTTCTGGCTGGCCACACCCACGCAGAC
CTCGATGGATCTGGTGTGACCGAAGGACGCCTTCGTCTCGATCGCCTTGGCCGCAACG
GCCATACGCGACTTTCTTCCCCTGCAAACAGGTTTGCATTCCTCGCGGGCCAAgaaagccg
ctcccggccgtcctccacttcgttccggccgccagcggtgcggcgtcgatcgccgtcggccttaacaccgtcatcgagaacgcgatgggcgcggcccgag
ctaaccggaaaaggagcacgacaATG

    tiorf76


Gene: tiorf76     GI: 17939252     BI number: Atu6119     GOG: COG5489     Description: conserved hypothetical protei


            C
          T  T
           GC
           CG
           TA
          T  T
          C  |
          C  |
           GC         A
           CG       C  A
          A  |       GC
           GC        CG
  C        GC        CG
A  G       AT        GC
 GC        AT        GC
 GC       G  |       TA
 AT        CG       |  T
 AT        CG       T  A
 GC       A  C      C  C
C  |       GC        CG
 CG        TG        GC
 AT        GC        CG
 GC        TA        TA
                        CTTTCTTCCCCTGCAAACAGGTTTGCATTCCTCGCGGGCCAAgaaagccgctcccggccgtcctccacttcgttccggccgccagcggtgcggcgtcgatcgccgtcggccttaacaccgtcatcgagaacgcgatgggcgcggcccgagctaaccggaaaaggagcacgacaATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[S] COG5489 Uncharacterized conserved protein ... can be seen here

    ..................................................................................................................